Coding
Part:BBa_K4769213:Design
Designed by: Kieran Abbott Group: iGEM23_Cambridge (2023-10-10)
bpr coding sequence from B. subtilis 3610
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 3363
- 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 3363
- 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 3363
Illegal BglII site found at 222
Illegal BglII site found at 3255 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 3363
- 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 3363
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI site found at 3226
Design Notes
N/A
Source
B. subtilis 3610 genome
Primers for cloning: FW: atgaggaaaaaaacgaaaaacagactc (+ desired overhangs) RV: ttaattttctgtgttcatattaagttttccattcg (+ desired overhangs)